Athiests, if love is a family trait where did the your family come from where di

Question:This was a answer to a question I had earler today.

An Athiest said that love was a family trait passed down thru family.

God is LOVE and he loves you. 1 John 4:7-8

Best Answer - Chosen by Asker: This was a answer to a question I had earler today.

An Athiest said that love was a family trait passed down thru family.

God is LOVE and he loves you. 1 John 4:7-8

Again I am not an atheist but I really don't think they are capable of understanding a 3rd grade question.

huh?

Are you stating that love does not come from family? I'm lost. Someone convert me!

I think you would get a much better response if you were to re-direct your question to the Religion and Spirituality forum,
http://uk.answers.yahoo.com/dir/;_ylt=As...
they could answer your question much better than the researchers on thei forum.
Hope this helps.

How can you tell what you folks are talking about? Confusing, I hope you come to a compromise....

This is not a genealogy question. It is about religion, family, or love, but is NOT genealogy.

If an Atheist answered that in that manner, they were incredibly stupid. Not only that, where love comes from has nothing to do with religion or genealogy, but human emotions and though processes... perhaps your question would be better placed in the psychology forum and rephrased as:

Why do human beings have the capacity to love and from where does it come?

Just my thought.

A more detailed explanation is that love is a sequence in your DNA. Indeed research has proven that love is the sequence "GAATCTCTTAATTTCCCTTTAG" on chromosome #5. People who lack this sequence are unable to love. People where this sequence is reduplicated are hopeless romantics. The sequence probably was created by spontaneous mutation about 200.000 years ago from a very similar sequence that gave its bearer a taste for mammoth bolognese. It "won" over the unmutated gene and replaced it, because all bearers of the mutation continuously engaged in sexual activity, while the non-mutants dozed around idly in McUgga restaurants and eventually died out.

Experiments, especially those conducted by G.A. Bayse-Dilleter of the University of Zwornitz, Eastern Germany, in the late 1970s, have shown that if the first T in the sequence is replaced with a G, people start to like rhubarb-flavoured lollipops. If it is replaced with an A, however, they go hopelessly insane. A commercial use for this stunning finding has yet to be discovered.